Query (optional)   in Class  

GrainGenes Probe Report: BQ167580-3D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BQ167580-3D
Data at Wheat_SNP
BQ167580-3D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>T;INS at 150;431,2
[ Show all 7 ]
Type
EST
SNP
PCR primers
BQ167580_cpR1 TTTGCTCTTGGGAACTCAGC
BQ167580D_F1 CGGTACATGTAATTGCACAGCTT
Sequence
WHE0077_G05_N09ZK
Linkage Group
3D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01