Query (optional)   in Class  

GrainGenes Probe Report: BQ168165-5A

[ Printable Version ]  [ Submit comment/correction ]

Probe
BQ168165-5A
Data at Wheat_SNP
BQ168165-5A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP DEL at 276-293
Reference sequence AGTTCTTCTGCTTATCAGTTATTGTAGAATTTCTGCTTATATGTTTGTGTAGCATGAATGGGAAAAGAATAATTGTCTTCACAATTCCCGGTCATGTAGCTATTTGCATATAGGATATGCATTAAGTTGATCTATCTTTAATTCACAAAAGGTTTATCGACTTATCATGTTCTTCAATGATTTAGTTAAGATACATTCTTCAAGATATTGTGCATGAGTGGAACATACTGTAACTTTGCATATTGTGTGCATCACAAAGAGAGGGCATGCCAATTGTTTGTTTAACTTACATTATCATCCATGTGCCTCTAGTTTCTAGTTTCTGAACTTATTAGTATCCTTGCAGGTGTACTTTTGGAGTCTTCCCAGTTGTGCCGGAAATCAGGTATTTCTATGATAAAGTGAACTCTGCTCTTCTTTCATTGCATAATGTCATTATTAAACTTTGACTTTGCATGTATGTATGGTTGGACTTTCACGACAACCGACAACGCATGATGATACGAATTAAGTCCATCACCTGTAACTTCTTAAGGGTGACTTATAACA
Type
EST
SNP
PCR primers
BQ168165A_R1 GCACCACTGTTATAAGTCACC
BQ168165_cpF1 CAAAGCCTGGTGGATGATG
Linkage Group
5A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01