Query (optional)   in Class  

GrainGenes Probe Report: BQ168165-5B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BQ168165-5B
Data at Wheat_SNP
BQ168165-5B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 11
SNP A>C;T>C at 12;42
Reference sequence TTCTTCTGCTTACAGTTATTGTAGAATTTCTGCTTATATGTTTGTGTAGCATGAATGGGAAAAGAATAACTGTCTTCACACTTCCCGGTCATGTAGCTATTTGCATATAGGATATGCATTAAGTTGATCTATCTTTAATTCACAAAAGGTTTATCGACTTATCGTGTTCTTCAATGATTTAGTTAAGATAATACGTTCTTCAAGATATTGTGCATGAGTCGAACATACTGTAACTTTGCATGCTGTGTGCATCACAAAGAGAGGGCATGCCAATTGTTTGTTTGACTTACATTATCATCCATGTACCTCTAGTTTCTAGTTTCTGAACTTATTAGTATCCTTGCAGGTGTACTTTTGGAGTCTTCCCAGTTGTGCCGGAAATCAGGTATTGCTATGATAAACTGAACTCTGCTCTTCTTTCATTGCATAATGTCATTATTAAACTTTGACTTTGCATGTATGTATGGTTGGACTTCCACGACAGCCAACAACACATGTTGATACCAATTAAGTCCATCACCTGTAACTTCTTAAGAGCGACTTATAACAGTGATGCAGAGTAGAAAAATCTCAATAAATTAATCTCTTTCTAGTGCACTTCCGTATCCTTGTTGATCATTAAATGTTAGAATAGAGATTCAGGCTAATCCTGTTCTGTGAATTTGTTTTTAGCTGAGGACTACCTACAATAAGCTGGAGTCTGATCTTTCAAACTCTAAAAAACGTTACATGGAGCTTCTTGAGCAGAGAGACGACTTGAAAAGAGGCAGGGAAGACACTGTAAGTTGTTCTCCATCTCCTCTATGAGCTGTGCAAGAAGCATGTAGATCAACTCATGTACATTCCTCTAGGATGAGAGAGAAGACGCTTTGGAGGAGCT
Reference sequence AGTTCTTCTGCTTACCAGTTATTGTAGAATTTCTGCTTATATGTTTGTGTAGCATGAATGGGAAAAGAATAACTGTCTTCACACTTCCCGGTCATGTAGCTATTTGCATATAGGATATGCATTAAGTTGATCTATCTTTAATTCACAAAAGGTTTATCGACTTATCGTGTTCTTCAATGATTTAGTTAAGATAATACGTTCTTCAAGATATTGTGCATGAGTCGAACATACTGTAGCTTTGCATGCTGTGTGCATCACAAAGAGAGGGCATGCCAATTGTTTGTTTGACTTACATTATCATCCATGTACCTCTAGTTTCTAGTTTCTGAACTTATTAGTATCCTTGCAGGTGTACTTTTGGAGTCTTCCCAGTTGTGCCGGAAATCAGGTATTGCTATGATAAACTGAACTCTGCTCTTCTTTCATTGCATAATGTCATTATTAAACTTTGACTTTGCATGTATGTATGGTTGGACTTCCACGACAACCAACAACACATGTTGATACCAATTAAGTCCATCACCTGTAACTTCTTAAGAGCGACTTATAACAGTGATGCAGAGTAGAAAAATCTCAATAAATTAATCTCTTTCTAGTGCACTTCCGTATCCTTGTTGATCATTAAATGTTAGAATAGAGATTCAGGCTAATCCTCTTCTTTGAA
Type
EST
SNP
PCR primers
BQ168165B_R2 TGAAAGATCAGACTCCAGCATA
BQ168165_cpF1 CAAAGCCTGGTGGATGATG
Linkage Group
5B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01