Query (optional)   in Class  

GrainGenes Probe Report: BQ169669-7B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BQ169669-7B
Data at Wheat_SNP
BQ169669-7B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;DEL at 1;178-180
[ Show all 6 ]
Type
EST
SNP
PCR primers
BQ169669B_R2_MSU ACTCTTATTTTCATCTCTGG
BQ169669_cpF1_MSU GAATTGCAGCCTTAAATGGG
Linkage Group
7B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01