Query (optional)   in Class  

GrainGenes Probe Report: BQ169729-3D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BQ169729-3D
Data at Wheat_SNP
BQ169729-3D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G;C>T;A>G;INS;T>G;C>T;G>C;G>A;A>G at 150;151;153;169,4;195;198;211;226;227
Reference sequence CGCTGATGAAGTAGAAGGGGCCCGGGCGGTCCAGGCGCACCTCGGTGTCGCCGTTGTTGGAGAAGAAGATGGGGTGCGTCGACCCGCACTTGTCGTACTCCTCCTGCGTCACCTCCATCACCGAGTCCGCCTTGTACTTGAAATCTACCACCAATCCATCACATGCATTACGTGTTAACAAAGGCGTATCGATCTGGCGGATGGATCAAAGGAGCGGGTCGAGTGGATCGATCTTACGGACGCTGTCGCCGACGAGGAAGCGGTTCT
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01