Query (optional)   in Class  

GrainGenes Probe Report: BQ170052-5D

[ Printable Version ]  [ Submit comment/correction ]

Probe
BQ170052-5D
Data at Wheat_SNP
BQ170052-5D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A;A>T;G>A;T>A;T>C;A>G;T>A;A>C;G>A;T>A;A>C;T>C;A>G at 32;116;148;248;312;323;325;332;333;355;363;391;435
Reference sequence AATGGATGAAATCGTAGAGCTGGGCGCTCACGCTCACCTGATCAAGAGGCGCGCAGAGCGCGTGTGCATGGTGAGATTGAGATGCAAGGGGATCAGATAAGTGACATCAAGCTTAATAGTAATTGATCGAACCTTGTATGGTGTTGGGTTTAACTTCCTCAGATGGTCCGGCCTCATCCGTTCCAGCTGACGCATGCACCGACTCCTGTTCTCATTGAGGGATGGCAGCTCCTCCCTTTGTACGGCTTCGGCATTGACAAGAGGATAAAGATTGGCATCAATGTCCTTTTCAACTTGAGACACACAAGTTATGATTTATGACATTTACATTAGGATGGACCAGATTCAGTACTGTGATATGTAGAACAGTAGAAGCTACTCGAGTGGATATACATACATGAATTTCCAGGCCAGTAGCACTTCAACAACTCCTCAACATGCTGTGGAACAACATGAGCTCTCTTTGACTCGATGAAAGGGTGACGA
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01