Query (optional)   in Class  

GrainGenes Probe Report: BQ171643-5,6B

[ Printable Version ]  [ Submit comment/correction ]

Probe
BQ171643-5,6B
Data at Wheat_SNP
BQ171643-5,6B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>G at 75
Reference sequence AAAAGGCAGCTGAATAAGCTAGGATAAATGTTGCTGTATTTTTATATGTTTGCACCGTTTCCAAACATGTCTTACTTTATGTATGTTTTCTTCGAAGCTTTGCTATTAGTTTAATGCAATAACTTATTTGCTTTGTATGAAGTCAAATCATGTTTTAGACAAAGCTTCCCACCTTATTTCTGTGACCATCCTAAAAAAATAGAAGAATAAAATGCATCTCATTGATTCTTTTGGTTAGTGACTAGTCACTACATGGTTGTTCATAAAAAGGAGAATATATGGTAAAGGCTGTTAAGAATGGTTCTTTTGTCTTGGTTTTGCTAGTTAATTGATGGTGTTTTCTGAATCTCCGAGCTTATTCTTATTTTTAACTCAATGATCGCCAGGAGTCCCCTCAAAATGCTCGGGTAAAGGTTTTGGCAAGT
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01