Query (optional)   in Class  

GrainGenes Probe Report: BS00001128_51

[Submit comment/correction] [What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
BS00001128_51
Locus
BS00001128
BS00001128_51
IWB5783
Reference
ReferenceWang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
ReferenceAllen AM et al. (2011) Transcipt-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.) Plant Biotechnology Journal 9:1086-1099.
Type
SNP
KASP
PCR primers
FAM 5' ACGTGCAAGACTAATAAACACGTACT 3'
Common 5' CTTCCACTTCGGAGATACTATCTCCTT 3'
VIC 5' CGTGCAAGACTAATAAACACGTACG 3'
Common 5' CTTCCACTTCGGAGATACTATCTCCTT 3'
Specificity
FAM primer specific to A allele, and VIC primer specific to C allele.
Sequence
BS00001128_51

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.