Query (optional)   in Class  

GrainGenes Probe Report: BS00003831

[ Printable Version ]  [ Submit comment/correction ]

Probe
BS00003831
Locus
BS00003831
Reference
ReferenceYu L et al. (2014) A consensus map for Ug99 stem rust resistance loci in wheat. Theoretical and Applied Genetics 127:1561-1581.
ReferenceAllen AM et al. (2011) Transcipt-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.) Plant Biotechnology Journal 9:1086-1099.
Type
KASP
PCR primers
FAM 5' CAGAATAAAGAAGTTTGGTTTGTGTAGTG 3'
Common 5' CACACAACGGGAGTAATATTCTTCATATTA 3'
VIC 5' CAGAATAAAGAAGTTTGGTTTGTGTAGTA 3'
Common 5' CACACAACGGGAGTAATATTCTTCATATTA 3'
Specificity
FAM primer specific to C allele, and VIC primer specific to T allele.
Sequence
BS00003831