Query (optional)   in Class  

GrainGenes Probe Report: BS00010742

[ Printable Version ]  [ Submit comment/correction ]

Probe
BS00010742
Locus
BS00010742
Reference
ReferenceAllen AM et al. (2011) Transcipt-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.) Plant Biotechnology Journal 9:1086-1099.
Type
KASP
PCR primers
FAM 5' GATGATGAACAAGTGGCCCCTC 3'
Common 5' ACGCAAAACCGCATACATCATTGGATTT 3'
VIC 5' AAGATGATGAACAAGTGGCCCCTT 3'
Common 5' ACGCAAAACCGCATACATCATTGGATTT 3'
Specificity
FAM primer specific to C allele, and VIC primer specific to T allele.
Sequence
BS00010742