Query (optional)   in Class  

GrainGenes Probe Report: BS00098483_51_KASP

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
BS00098483_51_KASP
Locus
BS00098483_51
Reference
ReferenceNannuru VKR et al. (2022) Genetic architecture of fusarium head blight disease resistance and associated traits in Nordic spring wheat Theoretical and Applied Genetics 135:2247-2263.
Type
KASP
PCR primers
Forward 1 TCAGATAAGCAGCAGGGACAT
Forward 2 TCAGATAAGCAGCAGGGACAG
Common GAAAGGGAATTATACGGTCCAGA

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.