Query (optional)   in Class  

GrainGenes Probe Report: BaAK12I12

[ Printable Version ]  [ Submit comment/correction ]

Probe
BaAK12I12  [ Marker Report ]
Locus
k06326
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks
Best BLAST Hit = putative Rab5-interacting protein - like [Arabidopsis thaliana]
Type
PCR
PCR primers
Left 5' - TCCTGCTATTCTGCGTTCCT
Right 5' - CGCGACTCCCAATTTTTAGA
Sequence
BQ665919
PCR size
363