Query (optional)   in Class  

GrainGenes Probe Report: Bmac144

[ Printable Version ]  [ Submit comment/correction ]

Probe
Bmac144  [ Marker Report ]
Locus
Bmac0144a
[ Show all 13 ]
Synonym
Other nameBmac0144
Reference
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks
Insert contains repeat (AT)4(AC)20
Quality = 3: Strong major polymorphic product, with additional strong bands. Multi-locus or weak but scoreable products
Type
PCR
SSR
PCR primers
5' TACGTGTACATACTCTACGATTTG 3'
5' ACTTATTCTGCATCCTGGGT 3'
SSR size
179
Amplification Conditions
1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species
Hordeum vulgare