Query (optional)   in Class  

GrainGenes Probe Report: Bmag0369

[ Printable Version ]  [ Submit comment/correction ]

Probe
Bmag0369  [ Marker Report ]
Locus
Bmag0369
Synonym
Other nameBmag369
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type
SSR
PCR primers
CACTAGGCACCAATGACTG
ATCGAAAATCTTAGCTTTGG