Query (optional)   in Class  

GrainGenes Probe Report: Bmag0603

[ Printable Version ]  [ Submit comment/correction ]

Probe
Bmag0603  [ Marker Report ]
Locus
Bmag0603
Synonym
Other nameBmag603
Reference
ReferenceHayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80.
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
Type
SSR
PCR primers
ATACCATGATACATCACATCG
GGGGGTATGTACGACTAACTA
Forward ATACCATGATACATCACATCG
Reverse GGGGGTATGTACGACTAACTA