Query (optional)   in Class  

GrainGenes Probe Report: Bmag0876

[ Printable Version ]  [ Submit comment/correction ]

Probe
Bmag0876  [ Marker Report ]
Locus
Bmag0876
Synonym
See alsoBmag876
Reference
ReferenceHayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80.
PCR primers
Forward AATTAAAAGCTGAAGGTCTACA
Reverse CTGCTCCTTCAACGACTAC