Query (optional)   in Class  

GrainGenes Probe Report: Bmag113

[ Printable Version ]  [ Submit comment/correction ]

Probe
Bmag113  [ Marker Report ]
Locus
Bmag0113c
[ Show all 17 ]
Synonym
Other nameBmag0113
Reference
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks
Insert contains repeat (AG)18
Quality = 3: Strong major polymorphic product, with additional strong bands. Multi-locus or weak but scoreable products
Type
PCR
SSR
PCR primers
5' GGAATCTTCTGGAACGTC 3'
5' TTAAGAAGATCATTGTATTGAAGA 3'
SSR size
153
Amplification Conditions
1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species
Hordeum vulgare