Query (optional)   in Class  

GrainGenes Probe Report: Bmag382

[ Printable Version ]  [ Submit comment/correction ]

Probe
Bmag382  [ Marker Report ]
Locus
Bmag0382
Bmag382
Synonym
Other nameBmag0382
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks
Insert contains repeat (AG)7AA(AG)7
Quality = 2: Single product, relatively strong stutter bands
Diversity Index (DI) = 0.36
Type
PCR
SSR
PCR primers
5' TGAAACCCATAGAGAGTGAGA 3'
5' TCAAAAGTTTCGTTCCAAATA 3'
TGAAACCCATAGAGAGTGAGA
TCAAAAGTTTCGTTCCAAATA
SSR size
109
Amplification Conditions
1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species
Hordeum vulgare