Query (optional)   in Class  

GrainGenes Probe Report: Bmag507

[ Printable Version ]  [ Submit comment/correction ]

Probe
Bmag507  [ Marker Report ]
Locus
Bmag0507
Bmag507
Bmag507-7H
Synonym
Other nameBmag0507
Reference
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks
Insert contains repeat (AG)23
Quality = 1: Single product, only weak stutter bands
Diversity Index (DI) = 0.69
Type
PCR
SSR
PCR primers
5' CAACTAGCATACCCAAGCTATA 3'
5' ACCCCTATTTCAATAATGGA 3'
SSR size
147
Amplification Conditions
1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species
Hordeum vulgare