Query (optional)   in Class  

GrainGenes Probe Report: Bmag692

[ Printable Version ]  [ Submit comment/correction ]

Probe
Bmag692  [ Marker Report ]
Locus
Bmag0692
Bmag692
Synonym
Other nameBmag0692
Reference
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks
Insert contains repeat (CT)19
Quality = 1: Single product, only weak stutter bands
Diversity Index (DI) = 0.72
Type
PCR
SSR
PCR primers
5' GCAAGGTATCTCTTGTATTTTG 3'
5' TGGCATCTACAATCTAAAACA 3'
SSR size
182
Amplification Conditions
1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species
Hordeum vulgare