Query (optional)   in Class  

GrainGenes Probe Report: CA684915-5D

[ Printable Version ]  [ Submit comment/correction ]

Probe
CA684915-5D
Data at Wheat_SNP
CA684915-5D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>T;T>C at 136;402
SNP T>C at 402
Reference sequence GTAGGTAGGTAAGGTGTATGGACGCGCTTCGTCGTTGCTAGTTGGGCTTCGACCCCCGCCCGTAGCCTGTTCGACCGAATGCCTGGGAGATCCCGCGCTCGCTTTGTTAGTGAGAAGGCTGCAGGAATCGAGACCGAACGTCTCTGCGAGTGGCGTGGCCTGCTAGTCTAGGCACCAATACTGGGTGGTGGCAATGCAAGGTTTAATCCTCATGGTCGTGGGACAGTTGTGCTGGGGTATCTTATTTGTGGAGGTTGCTTTCCTCTGTTGAAAGCAACCACGGCAGATGCCTCTGTTGAGGGCTTTGGAACAAATAGAATTTGTGTCAGCAGAGAGTAGATAGGCATTACAATACTACTTGGCAATATGTTCCCCTACTCTGATTGTGTGGCGAGCTCATGTCCTGTTGATGAATACAATGCAGATTTATGATGTGACCGCGTATTTGGATGACCATCCTGGGGGTGCTGATGTTCTGCTTGCCGTGACTGGTACTGCTTCTCTCCTCCTGTTTTC
Type
EST
SNP
PCR primers
CA684915D_F1 GGTAGGTTGGTAGGTAGGTAA
CA684915D_R1 TACCTTCAAACGTATTATCATAC
Linkage Group
5D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01