Query (optional)   in Class  

GrainGenes Probe Report: CAB-2

[ Printable Version ]  [ Submit comment/correction ]

Probe
CAB-2  [ Marker Report ]
Locus
Cab2
Synonym
Other namepKG1490
Type
STS
PCR primers
CATAAGCTGAATTCCAACACCG
ACTAGTCGACGAAGTTGGTGGCGAAGGC
Source Species
Hordeum vulgare
Clone Authority
Blake, Tom
Data Source
Blake, Tom93.04.09