Query (optional)   in Class  

GrainGenes Probe Report: CD373508-7A

[ Printable Version ]  [ Submit comment/correction ]

Probe
CD373508-7A
Data at Wheat_SNP
CD373508-7A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;G>A;C>T;T>C;A>T;A>T;G>T;C>G;G>A;G>T;C>A;C>G at 43;51;84;87;89;90;91;221;227;452;495;497
Reference sequence TTGGTGACCTTGATCGGGCTATCATGTTCTACGAGAAGGTATCGTATTGTGAAATGGGAGGTTGTTTGAAATGTTGGAGACAACATTCAAGCTGTATATTCTCTAGAACAATAGTTATATGTGGGATATTCTAACATTTGACTTTTATGCAGGCCCTTGGGATGAAGCTTCTGAGGAAGAAGGATGTGCCTCAGTATAAGGTACATCACATGACAATTGTCTTTTCGTGCCATTTGTCCTCTAAATTTTGATATACTGAGCATGTTTATGATTTGTGCAGTACACTATTGCCATGATGGGCTATGCTGAGGAGGACAAGACCACTGTTCTGGAGTTGACATACAACTATGGTGTCACGGAATATAACAAGGGCAATGCATATGCTCAGGTATTGACAAGTTTTCTTCTGCGCTTATTTCCTCTTTTAAGTTTTGGCATTTCTTAATGCTTGGGTTGCCTAACTGCAGGTTGCTATTGGCACTGACGATGTGTACCACAGCGCCGAAGCAGTTGAGCTGGTTACCAA
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01