Query (optional)   in Class  

GrainGenes Probe Report: CD373508-7D

[ Printable Version ]  [ Submit comment/correction ]

Probe
CD373508-7D
Data at Wheat_SNP
CD373508-7D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T;A>G at 557;558
[ Show all 6 ]
Type
EST
SNP
PCR primers
CD373508_cpR1 GAGCTTATCCAGAGGGGTCC
CD373508D_F2 CATTAAGAAATGCCAAAACTTATAG
Sequence
NSFT03P2_Contig18734
Linkage Group
7D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01