Query (optional)   in Class  

GrainGenes Probe Report: CD373635-7,2,1,6D

[ Printable Version ]  [ Submit comment/correction ]

Probe
CD373635-7,2,1,6D
Data at Wheat_SNP
CD373635-7,2,1,6D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>G;C>T;T>G;T>C;C>T at 42;75;77;287;288
Reference sequence GATGTTGCTGTTAAGGTATTATTCTGTCTAATGAATTCTTGTATTCTAATATATATGTTAGTGATCCCTATCCCCTTCAAGTTCTATATGTGTTCATTAATTGTTTAGAAGTCCGCTCACTGTGTGTTAATTGTGACTGTACAACCTAGTTGTGTGAGCATCCACTGATACCCTAGTCTCTAAAAATTCTGCCTGTCAACACTAACTGGTCTAAATGTTAAAGAGAATCTTATTGTCCATTCTTTTGTGTGTCTACTTGACATTGAACTACTTCTGAGTCATGCATTCAGCCTTGCCTTGATCAATGCTCTGCTTTGTGTATTAGGACATCATTTTTTGTTTCAATTATGTGTTTATAGTTGTGGCATTCTGTTCTTGTTATCAATTGATAATAGAATGACTCTTCAGATCTTTGTAGGGGTTATGCATGATTCTCATTCTTGTTCATTTGCGATGCTACTTTGTGTATCAGGGCAGCAGTTTATCAAAATTATGTGTTTGGTAGTTGTGGCATTCTGTCCTTGTTCATTTGTAACTCTGATCTTAACATGAACCAAAACTCATGTATGATGTCTATGCTTCAGGTTTCTGGGAGATGTATGACCCAGAGGGCTACTCTCTCTGGTTCTGTGACTACAGTACCAGGAAGAGAACACCGTGTCCTACGTGACCCTGAACAAGGTCGGCGGGTTCCTGCAGCGGATGGATCTGTGCCGC
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01