Query (optional)   in Class  

GrainGenes Probe Report: CD452413-3D

Probe
CD452413-3D
Data at Wheat_SNP
CD452413-3D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS;C>A;C>T;DEL;G>C;G>T;C>T;A>G;G>A;A>G at 57,2;156;277;393-395;397;398;445;451;454;466
Reference sequence GCTTTCTTCGGTTAGTTTCCTGCTGCTATTTTGGTTATTCAGTTGAATCCTGAAGCAGACAGTATATATCACGAGTGACAAAGGGCAACACCTACCTACTGCACTTCATTTCTGTTGGAAAGTCTTCCCCTGGTTGCACGAATATGTAATGTGTACCCGAGAAGAAAATGGAGGTCAGAGTAGGCACAAAATGAATAAAGGTGTGTGGTTGAGGGCATTTTTAATGGACGGCTCTCTCGTTGTTAATGAATTGGCAATGGTGTGTTTGAGTGGGTCCATTCACGGGGCTGTTTTAATGGAATTGCAATGTTGTAACCAAGTAGCTACTGTTTCTGACATTGCTGTTTGTTAATTATTCTTTGTTCCGACATGTTCACTAATACTCTGGTCTTCCCCGGCCGCAGGCATGCCTGGTTTTACAGCTTATGTTGGATTCTACGAAATCTGCTCACCGAAGAAAGGAGAATTTGTCTTTGTTTCTCTGGCCA
Type
EST
SNP
PCR primers
CD452413_cpR1 CCAGATGCAGCAGAAACAAA
CD452413D_F1 GGGCTTCTCGGTTAGTTTCC
Sequence
WHE1101_F11_K21ZT
Linkage Group
3D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01