Query (optional)   in Class  

GrainGenes Probe Report: CD452445-5,2,6D

[ Printable Version ]  [ Submit comment/correction ]

Probe
CD452445-5,2,6D
Data at Wheat_SNP
CD452445-5,2,6D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>T;T>G;G>T;C>T;T>A;T>C;T>A;A>T at 9;10;11;52;55;56;97;101
Reference sequence CTCAGAGTATGTATCTTGCTCTGCTATTTCTAATGTACAGAAACAATGTTTCTCTTCTCAGATGTTGTTAGACTACAACGATCTTATGAAGCTTCCTTTTAATGACATCCTTGACAAGAAGCTAAATGAAGAGGGGCTAAAGCTAAGGTATATTTTGATTTTATTTTAGAAGCAAAATTTTATTTAGTTTTGTAGTCTCCCAAATGTTTGCCCATAAGAAATCAATTATCTTGATTTACCTTGTTGTTTCAAAGGACTGATTCTACGGGAGAGATAAAGAATCAAGATATGCATCCTGTAGTGCTGACGCCAAAAATGCCAGGAAGGTTTTACTTCATCTTTGGGGAGCCTATTGAAACAAAAGGTAACCAGTTGCACTAGCAAATAGTAATCTGAAAAGATTTTTCTAAATGTTCCCATGGCAAGTCAACACACACTACACTGTTATTCTTTTCTGATGATTGAAAAACAAGAATGCATGC
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01