Query (optional)   in Class  

GrainGenes Probe Report: CD452643-6D

[ Printable Version ]  [ Submit comment/correction ]

Probe
CD452643-6D
Data at Wheat_SNP
CD452643-6D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>A;T>C at 243;306
SNP INS;INS;DEL;A>T;C>A;T>C at 12,1;20,1;48;50;300;363
Reference sequence CACTTGGATTTCTGAGAAGTACATGACAGAATGGTCAATGCATATCTTGAGGTCTACGCTTTCCAAATAATTTGTCGCGGTTGAAAACTATATTACACATGCCACATGTATTGAATCTATTTTGTGTGGCAACTGTTGATTCTGCAATGTCTCGTCCATTATACTAGTATCATGTCTAGTTGCCTCAACCATCTCACGCCACACTAAAGAGGGACAGACTAATTACACCAAGACGAATAATGAAGTTCAGTTGCTTAATTTAGCATTGTTAACTGAAAGTTGGAAAAAGCATTACAAAACATTTGGTTCTGCAACAGTTTTCCAAATTACCTTGTTTGCGTACTTCTCCACTAACAAAGGTATGTCAGATTTGGGTCTCCATCCT
Reference sequence TTTCCCAAAAATATTTGTCGCCGTTGAAAACTATATTACACATGCCACATGTATTGAATCTATTTTGTGTGGCAACTGTTGATTCTGCAATGTCTCGTCCATTATACTAGTATCATGTCTAGTTGCCTCAACCATCTCACGCCACACTAAAGAGGGACAGACTAATTACACCAAGACGAATAATGAAGTTCAGTTGCTTAATTTAGCATTGTTAACTGAAAGTTGGAAAAAGCATTACAAAACATTTGGTTCTGCAACAGTTTTCCAAATTACCTTGTTTGCGTACTTCTCCACTAACAAAGGTATGTCAGATTTGGGTCTCCTCCTCCCAAACA
Type
EST
SNP
PCR primers
CD452643_cpR1_USDA TTGTTTGGAGGATGGAGACC
CD452643D_F1_USDA TTTCCAAATAATTTGTCGCGTTT
Linkage Group
6D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01