Query (optional)   in Class  

GrainGenes Probe Report: CD453438-5D

[ Printable Version ]  [ Submit comment/correction ]

Probe
CD453438-5D
Data at Wheat_SNP
CD453438-5D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A at 303
SNP G>A;T>G;DEL;G>A at 56;102;132;540
SNP G>A at 514
Reference sequence AGCAGCTTAGTGCATCCAATTATTCCAAAATAATATCAGAATGTCACTTTAAGGTCCTAACTTGTTTTGCTAACCAAAGAACAATTATTCTTACCATAACAGCCTATTTAAGATTGCCAGCATATGTAAGGCTGCTTGGCAAGGAACTAACTAATGTTCTGCAAACACAATATAATAAGGTTCTTGACAAAGTACTATACACATGCATGAACTCAAAGAACTCATGACAGCAAATTTTAACTATACATGAGTACTTGTTTAGTCAAACACCAAACATTTTCCTAGGAATATTGAAGGAACAAGGGCAAGAACCACCAACTTTTGGAAATGAAATTCTTGAAATTAAATTCAATAAGATAAAGGCATAAAGTTACCTACAAGCAGAAAATTAATAAACAATACTGTCAAGAAAAAGGAACAAAAAATCACTGACCTTAGAATCAGAACTTGGTGAACTCGGGTATGAATTTGAAGGTCTCTTTGCACCATTTTCTTTAGCACAATCCGCGCACAGAAAAGTATCTAACTTTTTGGC
Reference sequence GCATCTCCTCACCGGGGATGGTTTTTGTTGAAGCGATTACCTCTTCCGCCTTTTCGGCTCAACCTGCAGTTGATGGGCCAAAATTAAAGAGGGATAGAAAATAATGTGCTGAATAAGCTATATCTTTTACTAAAAAAAAGCTATATCTTATATTAAGCTCATCTTCACCATGAAATACATGAACTGAGATCATGCTAATGGGTGACAATAACAAAGAAGATCCTAATCACTGCTGATAGCAGCTTAGTGCATTCAATTATTCCAAAATAATATCAGAATGTCACTTTAAGGTCCTAACTTGTTTTGCTAACCAAAGAACAATTATTCTTACCATAACAGCCTATTTAAGATTGCCAGCATATGTAAGGCTGCTTGGCAAGGAACTAACTAATGTTCTGCAAACACAATATAATAAGGTTCTTGACAAAGTACTATACACATGCATGAACTCAAAGAACTCATGACAGCAAATTTTAACTATACATGAGTACTTGTTTAGTCAAACACCAAACATTTTCCTAGGAATATTGAAGGAACAAGGGCAAGAACCACCAACTTTTGGAAATGAAATTCTTGAAATTAAATTCAATAAGATAAAGGCATAAAGTTACCTACAAGCAGAAAATTAATAAACAATACTGTCAAGAAAAAGGAACAAAAAATCACTGACCTTAGAATCAGAACTTGGTGAACTCGGGTATGAATTTGAAGGTCTCTTTGCACCATTTCTTTAGCACAATCCGCGCACAGAAAAGTATCTAACTTTT
Type
EST
SNP
PCR primers
CD453438_cpR1 CATTGAGCAGGCCAAAAAGT
Linkage Group
5D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01