Query (optional)   in Class  

GrainGenes Probe Report: CD453913-7A

[ Printable Version ]  [ Submit comment/correction ]

Probe
CD453913-7A
Data at Wheat_SNP
CD453913-7A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>G at 134
Reference sequence CGCCACAGGCTGGAAACAAGAAAAATAGAAAACTAAGGATTCTTTAACCATGTATGTGTACCTCCGGTCACAAAATTAAATTTAAAATGTTCTCAAGTGAAGAAAAGAGGAATTCTTGTTTTTAGATCGAGGGAAGAAACATATCCTTGTTCAACAAATAATATAGACGGAAAATTTAGAACCAATTTCTGTATTCAAACTATGGATATCTTAATAGCAAAGCTTGGTGTGTGTGTGTGTGTGTCACAAAATTTGAAGATTTTTCAAGGACAGGCAAATTGGACTATGTTCTGATAATCTAGATTTCAAAAGTACCGTTGGTGCAGCCGTTTAGTGAAGATATACCTTGATCATTTGCCGGAAACCTCCTGACACAAGGAATACTTCAGTATTATTAGCTTTTAATGTCTTAATCAAAT
Type
EST
SNP
PCR primers
CD453913A_F1 AGTAGGAATGCCAAGATCAC
CD453913_cpR1 CCTGGAATCGCAGATTTGAT
Linkage Group
7A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01