Query (optional)   in Class  

GrainGenes Probe Report: CD454024-6D

[ Printable Version ]  [ Submit comment/correction ]

Probe
CD454024-6D
Data at Wheat_SNP
CD454024-6D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>T;G>C;C>T;G>T at 10;80;146;201
Reference sequence ATCATACCTACTAAAAAATATAGCAATAGACAACCATCTTAGCGATAGACAAGCAAAGAATATTTATGCATATTCATGTGAAATGAAAAAAAAAAGGAACAGAAACCACTATCAAATAAGGCAACTGGGCAGAAGCTGCAGAACACATAGAGGAAGATGCTAAGGCTACAAAAATTGTGATGACTTTCCGCTTCCGCATTGTGAATATTTTACATTTTGTTTCAAAGATAGTTTAGAGCATGTCCATAATTCAAGAATCTCATTGTCTCCATAAAGAGGAAACTGGCCCCTCTCCAAATTGCACTGGGTTCTGTTTATCAAAGTGAGAAAAGACTGTTTATCTGATTGCCATAATTCATAAGAGTATATCAAACCCATATGTTGTCTTACCATGAGCAGATCGTATCCACTGGGCTGGGTAAATATAGGTATTTTTAATCAAGAATTCAAGATTTGCTTTTGTTTAAATGTGTTCTTTATATAGTAATTCGATATATTGCACCAGAACGCCATTTACTAGACCGATAAGAATCAAAAGGATCGAACTATGTATTTGTTGCTTGTATGTGAATCTTCCAGTGAATATCTAGTTGTATGAAGTACTGGTTCATGATATGAGTTGGGTACTGCTAAGCAGTATTGGGCCTTGACAGAAGTATTGGCACAGAACAAAACATGCCATTTCAAATTGGTGGGAACCACTTCTGTAGAT
Type
EST
SNP
PCR primers
CD454024D_F1_UCW TTCCATGCAAGTAGGCAAACA
Linkage Group
6D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01