Query (optional)   in Class  

GrainGenes Probe Report: CD454152-5A

[ Printable Version ]  [ Submit comment/correction ]

Probe
CD454152-5A
Data at Wheat_SNP
CD454152-5A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C at 621
SNP A>C;A>G;G>A;T>C at 265;564;580;621
SNP G>A;T>C at 580;621
Reference sequence TTTCTTCAGGAGCTAACCACAAACAGAAGAACCAACTAAACAAAAAAACAAGACTCTGCAGGATATAGATATTTATCATCATATTTTAGGCATCACCTATTTCCTGAACTGTAACTAAAATTCACTAACTTGGAAAAAAATATTCAAGCAAATACCTGTCGTCGAGATATTTTGTTCGCCCTCCCTTCTTTTGCTAAATCTATGTCTACTTTCACGTCTTCTGTCTCTCTTCCAAGAATAACCTGAGAAAAGAAGAGAGAAATGAAACTAAAAGTCAGAAATGGTGCCAAGATGCACAAATGCGAAAATATTATGTATTTCATACAAGTTAAAGAAGACAATTTGCCAAAAATTAATGGAAGTGAAAGCCACACAATAACCAGCCTGGTCGTATCTCTCTATTTAAAGATTGAATTAGAAGAAATGAAGAATTCAATCAGCATTCAATTATGAGACAGAAACAAGATAGATGAGTTTTCAAACTGCTAGTGAGTAGCAAGTGTGATGCTGTTCAAATAACCAAACATATGAATTGTTTCTATCTGCGAATATGAACACAACACAAAATTTAAACGATGCGACTGTTCAGCGCAGATGTATGAACATAAGTTCTCCGTACTTTGGAGAAGCTGAGTTGTGTCTCGTTATATGTGATGGACCATATTAGCTGAAAAA
Type
EST
SNP
PCR primers
CD454152A_F1 CCACCAATTACACTAAGAGCG
CD454152_cpR1 CGAGGTGCCTTTGCAGTTAT
Linkage Group
5A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01