Query (optional)   in Class  

GrainGenes Probe Report: CD454152-5B

[ Printable Version ]  [ Submit comment/correction ]

Probe
CD454152-5B
Data at Wheat_SNP
CD454152-5B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C at 245
[ Show all 6 ]
Type
EST
SNP
PCR primers
CD454152B_F1 ACCAATTACACTAAGATCACCG
CD454152B_R1 AGAGTACGGAGAACTTATGTTC
Linkage Group
5B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01