Query (optional)   in Class  

GrainGenes Probe Report: CD454152-5D

[ Printable Version ]  [ Submit comment/correction ]

Probe
CD454152-5D
Data at Wheat_SNP
CD454152-5D
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A at 1318
SNP G>A at 485
Reference sequence TGTCGGCGAGATATTTTGTTCGCCCTCCCTTCTTTTGCTAAATCTATGTCTACTTTTACGTCTTCTGTCTCTCTTCCCAGAATAACCTGAGAAAAGAAGAGAGAGAAATGCAACTAAAAGTCAGAAATGGTGCCAAGATATTGCACAAATGTGAAAATATTATGTATTTCATACAAGTTAAAGAAGACAATGTGCAAAAATAATAATGAAAGTGAAAGCCACACAATAACCAGCCTGGTCGTATCTTTCTACTTAAAGATTGAATTAGAAGAAATGAAGAATTCAATCAGCATTCGATTATGAGACAGAAACAAGATAGGTGAGTTTTCAAACTGCTAGTGAGTAGCAGGTGTGATGCTGTTCAGAAATAACCAAACATATGAATTTGTTTCTATCTGCAAATATGAACACAACACGAAATTTAAACGATGCAACTGTTCAGCGCAGATGTATGAACATAAGTTCTCCGTTCTCTGGAGAAGCCGAGCTGTGTCTTGTTATATGTGATAGATCATATTAGCTGAAAAACATCAGTTGGATTTACCTCAGGATCCTTTATGTAGTACTTCAAGTGCAGTCCATAGATAACTGCAA
Reference sequence GATACCGCCTGATTTTCAGAATATAGCACGAATTTAGCAAAACATAACACAGTGCCCACTATTTAGGGCAGTTCACCAGCCTGATACCCTAACTCGCAACTTAAAGGAGAACATGTGAATGGGGTTAGTGGATGCAACCACTGGGGGTCAGATGTAACCAGAGATGCCTGCTGTTAATTACTTAAAACAGTTAACTATTTCAGGAGCATGGCATGGTCAGACGATGTACAAATTACAAGATACACAGAGTCATAGAATGCCAAAAGGTCGCAATTTTATAATACAAGTGTGGTCAACATCAATAGCTGGAGATGTTTTTAAAACTATCCATAACAAGTCAAGAAAACAAAGTGTTAAGACTAACAGTTTCTCAATTTAATAATAACACAAAGGCATGGTACAAATCATTGAGATAAATATGCAAGTCAACCCTAGAGTGAAAAAAGAGACCTAGATAAACATAATTCATCCCCCACCAGACTTTTCCAGTCCCAAATATTGCCAACTAAACAAAGTCGACAACTCCACTGGCTCAAACAAACATGTGCCCTGCACGTTAAAATGTCTTCTGACAATGCATGACACATAAAGCTTTTTACTGCTGTCAGGGTCAGGGCAGAGTAGACCTTCTGTGGCCACCAATTACACTAAGACCAGCAGATGAGCTAAAAGTACATTTTCTTCAGGAGCTAACCTCAAACAGAAGAACCAACTAAACAAAAAAACAAGACTCTACCGGATATAGATATTTCTCATCATATTTTAGGCATCAGCTATTTCCTGAACTGTGACTAAAATTCATTAACTTGGAAAAAAATATTCAAGCAAATACCTGTCGGCGAGATATTTTGTTCGCCCTCCCTTCTTTTGCTAAATCTATGTCTACTTTTACGTCTTCTGTCTCTCTTCCCAGAATAACCTGAGAAAAGAAGAGAGAGAAATGCAACTAAAAGTCAGAAATGGTGCCAAGATATTGCACAAATGTGAAAATATTATGTATTTCATACAAGTTAAAGAAGACAATGTGCAAAAATAATAATGAAAGTGAAAGCCACACAATAACCAGCCTGGTCGTATCTTTCTACTTAAAGATTGAATTAGAAGAAATGAAGAATTCAATCAGCATTCGATTATGAGACAGAAACAAGATAGGTGAGTTTTCAAACTGCTAGTGAGTAGCAGGTGTGATGCTGTTCAGAAATAACCAAACATATGAATTTGTTTCTATCTGCAAATATGAACACAACACGAAATTTAAACGATGCAACTGTTCAGCGCAGATGTATGAACATAAGTTCTCCGTTCTCTGGAGAAGCCGAGCTGTGTCTTGTTATATGTGATAGATCATATTAGCTGAAAAACATCAGTTGGATTTACCTCAG
Type
EST
SNP
PCR primers
CD454152_cpR1 CGAGGTGCCTTTGCAGTTAT
CD454152D_F1 ATCAGCTATTTCCTGAACTCTG
Linkage Group
5D
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01