Query (optional)   in Class  

GrainGenes Probe Report: CD454223-2B

[ Printable Version ]  [ Submit comment/correction ]

Probe
CD454223-2B
Data at Wheat_SNP
CD454223-2B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP C>T at 184
SNP G>C at 253
Reference sequence GAGGAACCAAGAATGAACAAATTGGCAACCACCCACCGGAAAGAACAAACTGACTTACATACATCATCACACCCCGAAGAATGCAAACCAAGCCAATGCAGTGCACCAAATCCTAACAACGGCAGCAAGAAGAACAACGACAACACTTGGTTGTCCTGAGGCCGACGGGCCGGATCTTGATCACGAGGGTGCGGCGGTCCCCTCGCCGGCGATCAAGCCGTTGTTGTCGCTGCGGGCCAGGGGACGACCGTCGTCGTGTGCCGGGGGTTCTACATACCTAAGGCTCTGCTGCT
Type
EST
SNP
PCR primers
CD454223B_R1 AGCAGCAGAGCCTTAGGTAT
CD454223_cpF1 CAGATCAGGGGAAGTGGAGA
Linkage Group
2B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01