Query (optional)   in Class  

GrainGenes Probe Report: CD454314-7A

[ Printable Version ]  [ Submit comment/correction ]

Probe
CD454314-7A
Data at Wheat_SNP
CD454314-7A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A at 229
SNP G>C;G>C;C>A;C>T at 447;448;451;452
SNP T>C at 25
Reference sequence AGCGGCACTGAACTTGTGCTCCTTATGAGGATAAGGATGGTGATTGGATGCTTGTTGGTGATGTTCCATGGCGGTGAGTATTGAGTAATATGGATATTGATAAAATTATGCGCTAGCAATACAGATTTTGCAGCAATATTAATGCTTTTCATCTGTATTTGCAACTATCTAATCAGCGAGTTTTTTTTTACTTTCTATGTTGTCCATATGCATACACCCTGGCCTCCTGTGTCTTAAATATTTTAATGAAGTAACAAAGCTTAATACAGTAATGCATTTAATTTACTGGAGTACTTTAATTGCTGAAGTGTCTCATCTGGGGCTATTGATTTGGAGTGTTATTGAAAATTCATATCTCCCTCCTATGAAGATTTGGTTGAAATAATTTTGTACAAATAAATGGGAATGGTGCATGTTTTTTTTCGAGATTGAAGGGGGGGGGGGGGGGCCCCTTT
Reference sequence TCATTGGAATGTGCAAAATCTTGGTGGGCCAGGCATTGCAATGATGTGGCAGACTCATATGGGAAACAAAGTAATACATCATGGCTGGATGAAATCAAGAACTCACTAGAATGTCTTAAAAAAATTCAGCTTCACAAAACATGTACAAATCAAGAACCCGCTGGAATGTCTAAAATTGCTTTCTGTTCGACCCTTCTGTAATTCATTGCTGATGTAATGACCGCTTACGGTCGACTCCTTGGTATGGGGCTGCCAATCTCTTTTGAGTGCAATACGACAAATGGTGCCCCCCCCCCCCCCCTTTTCAATCTTGAAAAAAAACATGCACCATTCCCATTTATTTGTACAAAATTATTTCAACCAAATTTTCATAGGAGGGAGATATGAATTTTCAATAACACTCCAAATCAATAGCCCCAGGTGAGACACTTCAGCAATTAAAGTACTCCAGTAAATTAAATGCATTACTGTATTAAGCTTTGTTACTTCATTAAAATATTTAAGACACAGGGGGCCAGGGTGTATGCATATGGACAACATAGAAAGTAAAAAAAAAACTCGCTGATTAGATAGTTGCAAATACAGATGAAAAGCATTAATATTGCTGCAAAATCTGTATTGCTAGCGCATAATTTTATCAATATCCATATTACTCAATACTCACCGCCATGGAACATCACCAACAAGCATCCAATCACCATCCTTATCCTCATAAGTGAGCACAAGTTCAGTGCCGCTTTAA
Type
EST
SNP
PCR primers
CD454314A_F1 CATGTGGCTTTTTATGGACAG
CD454314_cpR1 TGGAAAATCGGGAAGAGATG
Linkage Group
7A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01