Query (optional)   in Class  

GrainGenes Probe Report: CD454314-7B

[ Printable Version ]  [ Submit comment/correction ]

Probe
CD454314-7B
Data at Wheat_SNP
CD454314-7B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP G>A at 232
SNP G>A at 305
SNP INS;C>T at 11,1;45
Reference sequence TCTGTGGTACACAATAATGAATATATTACCCGTCAGGTGGCTTTCTATGGACAAGATGAATACTGGATCAAGCTCAGGAACTCATTGGAATGTGCAAAATCTTGGTGGGCCAGGCATTGCAATGATGTGGCAGACTAATATGGAAAATAAAGTAATACAACATGGCTGGATGAAATCAAGAACTCACTGGAATGTCTTAAAAAAAAATTCAGTTTCACAAAACATGTACAAATCAAGAACCCACTGGAATGTCTAAAATTGCTTTCTGTTCGACCCTTCTGTAATTCATTGCTGATGTAATGACTGCTTACGGTCGACTGCTTGTATGGGGCTGCCAATCTCTTTCGAGTGCAATACGACAAATGGTGGGGACTCCCCCTCCCTCTATAATCTCGAAAAAAACATGCACCATTCCCATTTATTTGTACAAAATTATTTCATATGTTGAGCAAAAGAAATTACCAAATCTTCACTAGGAGGGAGATATGAGTTTTCAGTAACCATCCAAATCAATAGGCCCAAATGAGACACTTGAGCAATTAAAGTAGTATATTAAATGTATTGCCGCATCAAGCTTTGTTACTTCATTAAAATATTTAAGACACAAGGGGCAAGGGTGTATGCATATGCAGAATATTGCAAGTAAAAACAGAACTCGCTAATTAGATAGTTGCAAATACAGATGAAAATCATCAATATTTCTGTGAATTCTGTATTGCTAGTACATAATTTTATCAATATCCATATCACTCAATACTCACCGCCATGGAACATCACCAACAAGCATCCAATCACCATCCTTATCCTCATAAGTGAGCACAAGTTCAGTCCCGC
Reference sequence TCGACTGCTTGTATGGGGCTGCCAATCTCTTTCGAGTGCAATACGACAAATGGTGGGGACTCCCCCTCCCTCTATAATCTCGAAAAAAACATGCACCATTCCCATTTATTTGTACAAAATTATTTCATATGTTGAGCAAAAGAAATTACCAAATCTTCACTAGGAGGGAGATATGAGTTTTCAGTAACCATCCAAATCAATAGGCCCAAATGAGACACTTCAGCAATTAAAGTAGTATATTAAATGTATTGCCGCATTAAGCTTGTTACTTCATTAAAATATTTAAGACGCAAGGGGCAAGGGTGTATGCATATGCAGAATATTGCAAGTAAAAAAAGAACTTGCCAATTAGATAGTTGCAAATACAGATGAAAATCATCAATATTTCTGCGAATTCTGTATTGCTAGTACATAATTTTATCAATATCCATATTACTCAATACTCACCGCCATGGAACATCACCAACAAGCATCCAATCGCCATCCTTATCCTCATAAGTGAGCACAAGTTCAGTCCCGCTTTTAAGATCCATCAGTCGACAATCAGATAATCCATCTCTTCCCGAATTTTCCA
Type
EST
SNP
PCR primers
CD454314B_F2 GACTGCTTACGGTCGACTG
CD454314_cpR1 TGGAAAATCGGGAAGAGATG
Linkage Group
7B
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01