Query (optional)   in Class  

GrainGenes Probe Report: CD454441-6B

[ Printable Version ]  [ Submit comment/correction ]

Probe
CD454441-6B
Data at Wheat_SNP
CD454441-6B
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS;INS;C>T;A>C;C>T at 12,1;16,1;43;752;865
Reference sequence GGGCATTCTAAACTACCAAGTAGGTGAACTCTTGGATGAATGCAACATAATCTCTCAAAGCTGAGGGAAGCTTCAACTCGTCGCAGCTGCCAATAAGCTATCGGCTAAATCCATCTAGGAGACTGCTGTGTTATTATGTACCTGATAAAGTGTACATAGATTGGAGGGCAAGATTTCCTGTTACACCGAAGGAACCCAAATGTGACCTCAGTTTCTGTTCAGGTACACCCTGCAGAGACATTTTTTCTATGTTAGAGCAGAAATTTGTATCAAGTCAAATACCAAAAGGAGGGTAATATTTCTTTTTCTATATTACAGCTGAAATGTCCATTTAAAATAAATACCAAACAGACCATAATACACTTTCTTTCTATCAGAGCTGAAATGTATATTCACGGGAGAATATCTGGTACTCCCATCCCTAGGGTGCTCCCGGTGCTCCAAACTCAGGAGCATATTTTTAAATGTTCAGAAAATTCTGAAAAAAAATCTAGCACATTGACAACATCAATGTATGCTGTCAAAAAAATTCAAATCAAAATTCAAAACATTGCTCGAGATACAAAAATGACAAAATCGACATCAATGTGATAATGGGCCAAATCTAAAGCCCAACTTATGTTGTGTACTATTTACCGTCGAATTTGTCATTTATGTTTCTCAAGCCATGTTTCGAATTTTGATTTCAAATTTTGTGACAACATACATTGGCGTCGTGTCTATGTGCTGGGTTTTTTTTCAGAATTTTCTGAACATTCAAAAATGTGCTACCGAGTTTGGAGCACGGGGAGCACCCTAGGGGAGGGAGTACCAGATATTCTCCCCAAGTTAAATACCAAACAGAGCATACTGCCCACTACATCACGCTATACGAAATCTAGCATTTCATCGCCGCAAAAAATCATGATGCTTGAGCTACCG
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01