Query (optional)   in Class  

GrainGenes Probe Report: CD490511-4A

[ Printable Version ]  [ Submit comment/correction ]

Probe
CD490511-4A
Data at Wheat_SNP
CD490511-4A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP INS;C>G;T>C;G>A;INS;C>A;C>A at 4,1;72;250;419;526,1;579;586
Reference sequence GTGTAAGAAATGCAAGTTTGTTCTTCTGTTGCCATAAACATACAGTACTCATCTAGCTGCACCATCACCACCAGCTTTCACCCATTTTTCATTTTTCAGTTTTCACTAGTTCATGGTCAGACCTTATTCAGTATTCACTGCCTGCTAGTATTTGTTACTACTACCATCGTTGCTGCTGCAGAGCAGAGTTTTCGACACCATGTTTCTTTAAACTCGTTTACATGACCATTCGATACTTCCTTCTGCGATTGTTGTAAAACGTAGTGCGAAATACTTATCTTAACTGATCTTTTCTCTTCCCTTGCAATTCACAAGCTGGTACTTGACAGTCGCTTGCTAAGATCTATTTTATACTCTTACCTCTCATGTGAAAAGAGGGGGTAAGAGGGACCATGTTAAAACTGCTCTGTTTGTTTACGTTTTGTAGTGTATTTGCAGTTCAGTTTAGGTGAAAACTAGAATCATCATTTGCTTGTTATATGGATAAGAATCAGTGTATATGTTTTGTCGATACCTACATACTGGGCATTTTAATCTGCCGTAGGATCTACTATATTGTTAACACAAAGAATCATTACCTGGACCCTTTTT
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01