Query (optional)   in Class  

GrainGenes Probe Report: CD491981-6A

[ Printable Version ]  [ Submit comment/correction ]

Probe
CD491981-6A
Data at Wheat_SNP
CD491981-6A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP T>C;G>C;G>T;T>G;C>T;INS;C>T;G>C;G>A;C>G;T>C at 27;28;31;77;117;137,3;208;225;226;246;285
Reference sequence GGAGGCGGCACAAATGACGCTGATGATGAAGGCCGGGAAGGTAACAATTTCGCTGTGCATTGGTTTTACATGCTAATACCTGCTGTATTCGGTATAGCTTCAACCTGACTGAATTGCTGCATTCTCTGAATCCCCTCAGGTTCCCGCATGGGATCGATCAACATGAGCAACATCTTCACGGGGAAGTGCGTCGCCAAGATCTCGGCCCTGGACCCGACCCTCATGGTCGCTCCCCGGAGAAAAGGCGACACCAGCAGGTCCACCATCCGGAGCAGCGTGTCGGATGCCCTGGAGGACATCACGGCGCTCTTCTACGACGAGGACCGCAACGAGATCTACACC
Type
EST
SNP
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01