Query (optional)   in Class  

GrainGenes Probe Report: CF133109-3A

[ Printable Version ]  [ Submit comment/correction ]

Probe
CF133109-3A
Data at Wheat_SNP
CF133109-3A
Reference
ReferenceAkhunov ED et al. (2010) Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes. BMC Genomics 11:702.
General Remarks
SNP A>T;C>G at 26;139
SNP A>T at 26
SNP DEL at 139-141
Reference sequence GTGTTCTTGAGGACCAGGAGCTGCTAGTGCAGGATGCCATTGCCGCTGCTAATTCACCAAACAAGAGCTCCAGCAATGGCGGCTCACAGTCCGTGGTTCAATCCGACCCGGCGACGATTCCTGCTCCAGTCCAGCAGACTCCTCCTACCGTTCCAGTTCCAGAA
Type
EST
SNP
PCR primers
CF133109A_F1_UMN GGTGTTCTTGAGGACCAGGA
CF133109A_R1_UMN CTGGAACTGGAACGGTAGGA
Sequence
TC272151
Linkage Group
3A
Source Species
Triticum aestivum
Data Source
You, Frank Mingan2010.01