Query (optional)   in Class  

GrainGenes Probe Report: CFA2076

[Submit comment/correction] [What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
CFA2076  [ Marker Report ]
Locus
Xcfa2076-3A
[ Show all 6 ]
Reference
ReferenceSourdille P et al. (2001) Improvement of the genetic maps of wheat using new microsatellite markers Plant & Animal Genome IX Abstracts 167.
General Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (TG)18
Regularity of motif is imperfect
Type
PCR
SSR
PCR primers
Forward 5' CGAAAAACCATGATCGACAG 3'
Reverse 5' ACCTGTCCAGCTAGCCTCCA 3'
SSR size
172
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
3D
Source Species
Triticum urartu
Data Source
Sourdille, Pierre

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.