Query (optional)   in Class  

GrainGenes Probe Report: CFA2149

[ Printable Version ]  [ Submit comment/correction ]

Probe
CFA2149  [ Marker Report ]
Locus
Xcfa2149-4B
Xcfa2149-5A
Yr48
Xcfa2149
Reference
ReferenceLowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
ReferenceSourdille P et al. (2001) Improvement of the genetic maps of wheat using new microsatellite markers Plant & Animal Genome IX Abstracts 167.
ReferenceHegarty J et al. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease Resistance. Stripe Rust Resistance. Yr48 MAS Wheat. Marker Assisted Selection in Wheat.
General Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (TG)20
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' CTTGGAGCTCGGGTAGTAGC 3'
Reverse 5' AAGGCAGCTCAATCGGAGTA 3'
SSR size
231
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
4B
Source Species
Triticum urartu
Data Source
Sourdille, Pierre