Query (optional)   in Class  

GrainGenes Probe Report: CFA2163

[Submit comment/correction] [What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Probe
CFA2163  [ Marker Report ]
Locus
Xcfa2163a-3A
[ Show all 8 ]
Reference
ReferenceSourdille P et al. (2001) Improvement of the genetic maps of wheat using new microsatellite markers Plant & Animal Genome IX Abstracts 167.
General Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (TC)16
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' TTGATCCTTGATGGGAGGAG 3'
Reverse 5' CATCATTGTGTTTACGTTCTTTCA 3'
SSR size
163
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
5A
Source Species
Triticum urartu
Data Source
Sourdille, Pierre

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.