Query (optional)   in Class  

GrainGenes Probe Report: CFB275

[ Printable Version ]  [ Submit comment/correction ]

Probe
CFB275
General Remarks
Motif (TA)6
Type
Genomic
PCR
SSR
PCR primers
GTCAAGAAGTAAACGAGGCGG
GCGGCGGTGGAAATAGGG
SSR size
158
Amplification Conditions
Tm 60
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
DNA Origin
Chromosome 3B BAC ends
Data Source
Sourdille, Pierre2006.10