Query (optional)   in Class  

GrainGenes Probe Report: CFB3034

[ Printable Version ]  [ Submit comment/correction ]

Probe
CFB3034  [ Marker Report ]
Locus
Xcfb3034-3B
Synonym
Other nameCFT3034
General Remarks
Motif (TTTG)3
Type
Genomic
PCR
SSR
PCR primers
Forward TCACCGCACGTGCACAGC
Reverse CCTCTTTCAATCCAATCCACC
TCACCGCACGTGCACAGC
CCTCTTTCAATCCAATCCACC
SSR size
253
Amplification Conditions
Tm 60
Sequence
3B_007_O05_RM1
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
DNA Origin
Chromosome 3B BAC ends
Data Source
Sourdille, Pierre2006.03
Sourdille, Pierre2006.10