Query (optional)   in Class  

GrainGenes Probe Report: CFB3252

[ Printable Version ]  [ Submit comment/correction ]

Probe
CFB3252  [ Marker Report ]
Locus
Xcfb3252-3B
Synonym
Other nameCFT3252
General Remarks
Motif (TC)6
Type
Genomic
PCR
SSR
PCR primers
Forward TCTGCCCCTGTTTTCTATTTCC
Reverse TGCTCCCACTGCGAACTC
TCTGCCCCTGTTTTCTATTTCC
TGCTCCCACTGCGAACTC
SSR size
148
Amplification Conditions
Tm 60
Sequence
3B_004_B01_FM1
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
DNA Origin
Chromosome 3B BAC ends
Data Source
Sourdille, Pierre2006.03
Sourdille, Pierre2006.10