Query (optional)   in Class  

GrainGenes Probe Report: CFD132

[ Printable Version ]  [ Submit comment/correction ]

Probe
CFD132  [ Marker Report ]
Locus
Xcfd132-6D
H13
Xcfd132
cfd132
Reference
ReferenceGuyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
General Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (CT)6(CA)19
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' CAAATGCTAATCCCCGCC 3'
Reverse 5' TGTAAACAAGGTCGCAGGTG 3'
SSR size
150
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
6D
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre