Query (optional)   in Class  

GrainGenes Probe Report: CFD2

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
CFD2  [ Marker Report ]
Locus
Xcfd2-2A
[ Show all 28 ]
Reference
ReferenceGuyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
General Remarks
Quality Score = D
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (CA)21
Regularity of motif is imperfect
Type
PCR
SSR
PCR primers
Forward 5' GGTTGCAGTTTCCACCTTGT 3'
Reverse 5' CATCTATTGCCAAAATCGCA 3'
SSR size
288
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
2A/2D/3A/3D/4A/5B/5D
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.