Query (optional)   in Class  

GrainGenes Probe Report: CFD49

[ Submit comment/correction ]

Probe
CFD49  [ Marker Report ]
Locus
Xcfd49-6D
Xcfd49
cfd49-6D
SrTA10187
cfd49
Reference
ReferenceOlson EL et al. (2013) Introgression of stem rust resistance gene SrTA10187 and SrTA10171 from Aegilops tauschii to wheat Theoretical and Applied Genetics 126:2477-2484.
ReferenceGuyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
ReferenceMAS Wheat. Bringing Genomics to the Wheat Fields. Disease Resistance. Stem Rust Resistance. SrTA10187 MAS Wheat. Marker Assisted Selection in Wheat.
General Remarks
Quality Score = A
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (GA)33
Regularity of motif is imperfect
Type
PCR
SSR
PCR primers
Forward 5' TGAGTTCTTCTGGTGAGGCA 3'
Reverse 5' GAATCGGTTCACAAGGGAAA 3'
SSR size
214
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
6D
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.